Webctnnb2 ( 1) Sequence 5' - GGCAGTCCTACCTGGATTCA - 3' Select Tool Disclaimer Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent. Note The first "G" was added. Genome Resources None Target Location Genome Build: GRCz11 Chromosome: 19 … WebAug 6, 2024 · We provide a transgenic approach to inactivate maternal genes in zebrafish primary oocytes. By introducing three tandem single guide RNA (sgRNA) expression cassettes and a green fluorescent protein (GFP) reporter into Tg(zpc:zcas9) embryos, we efficiently obtained maternal nanog and ctnnb2 mutants among GFP-positive F 1 …
Anti-ctnnb2 Rabbit Polyclonal Antibody VWR
WebRNA isolated after 31 hours of constant light was analyzed by qRT-PCR and revealed a similarly large increase in sox2 expression in both SC and ctnnb2 morphant retinas relative to the 0 hour control, but not a significant difference between the SC and ctnnb2 morphant at 31 hours (I; Student’s t-test p = 0.07, n = 3). WebOct 29, 2024 · To confirm our findings, we further detected the expression levels of other Wnt target genes, such as tcf7l2, ctnnb1, and ctnnb2. Our results demonstrated significant upregulation of tcf7l2, ctnnb1, and ctnnb2 transcript levels in kdm6bb-MO embryos compared with the controls (Fig. 5e–5k). device trust type workplace
ctnnb2 Protein - Creative BioMart
Webctnnb2 has several biochemical functions, for example, protein binding, signal transducer activity. Some of the functions are cooperated with other proteins, some of the functions … WebMar 21, 2024 · CTNNB1 (Catenin Beta 1) is a Protein Coding gene. Diseases associated with CTNNB1 include Pilomatrixoma and Colorectal Cancer.Among its related pathways … WebAs an alternative to perfluorooctanesulfonate (PFOS), 6:2 chlorinated polyfluorinated ether sulfonate (commercial name: F-53B) has been used as a mist suppressant in Chinese electroplating industries for over 30 years. It has been found in the environment and fish, and one acute assay indicated F-53B was moderately toxic. devicetypeex